Home > JEPonline
Strength Training and Myosin Isoform Expression
Strength Training and Myosin Isoform Expression
JEPonline
Journal of Exercise Physiologyonline
Society
of Exercise Physiologists (ASEP)
ISSN 1097-9751
An International Electronic Journal
Volume 3 Number 4 October 2000
Effects Of High-Intensity Strength Training On Steady-State Myosin Heavy Chain Isoform Mrna Expression
DARRYN S. WILLOUGHBY1 AND STEPHEN PELSUE2
1Department of Kinesiology, Texas Christian University, Fort Worth, TX, 2Department of Applied Medical Sciences, University of Southern Maine, Portland, ME
DARRYN S. WILLOUGHBY AND STEPHEN
PELSUE. Effects Of High-Intensity Strength Training On Steady-State
Myosin Heavy Chain Isoform Mrna Expression. JEPonline,
3(4):13-25, 2000. The
purpose of this study was to determine steady-state myosin heavy chain
(MHC) isoform (Types I, IIa, and IIx) mRNA abundance in skeletal muscle
after 8 wks of high-intensity strength training. Twelve untrained
males were randomly assigned to either a control (CON) or strength training
(STR) group. During the study, STR trained at 85%-90% 1-RM for
3 sets of 6-8 repetitions thrice weekly employing the bilateral leg
press exercise while CON engaged in no strength training. Approximately
20-30 mg of muscle from vastus lateralis biopsies were obtained before
and after the study and a competitive method of quantitative RT-PCR
was performed to determine MHC isoform mRNA abundance. A synthetic
DNA fragment (555 base pairs) was designed as a competitive internal
control standard and a known amount co-amplified with the template DNA.
As a result of training, STR underwent significant increases in muscle
strength, thigh volume, and myofibrillar protein that were significantly
different from CON (p < 0.05). STR was also shown to
be expressing significantly more of the Type I and IIa isoform and less
of the IIx isoform that was also significant from CON (p <
0.05). This study indicates that high-intensity strength training
increases myofibrillar protein content and results in up-regulation
of the expression of the Type I and IIa MHC genes with concomitant down-regulation
of the IIx gene.
Key Words: strength, pre-translational, translational, RT-PCR
INTRODUCTION
Human skeletal muscle is a
highly-adaptable tissue that commonly demonstrates significant plasticity
in response to various types of exercise. This plasticity is well
illustrated by the isoform diversity (Type I, IIa, and IIx) of the sarcomeric
myosin heavy chain (MHC) genes (1). All the MHC isoforms are encoded
by a closely conserved multigene family (2) of distinct genes that are
expressed in a tissue-specific and developmentally regulated manner
(1,3). The diversity of these isoforms is augmented in some instances
by alternative RNA splicing of individual MHC genes; therefore, changes
in muscle activity from weight training alter MHC gene expression and
phenotype and affect muscle fiber types in characteristic ways (4).
The adaptability of skeletal muscle appears to reside in the ability
of the muscle fibers to transcribe different isoforms of MHC protein,
each which have specific functional characteristics (5) relative to
muscle contraction. Consequently, the polymorphism of the MHC plays
a major role in the adaptability and contractile efforts of muscle fibers
necessary for various types of exercise.
High-intensity strength training
in humans is characterized by increases in muscle strength and hypertrophy
(6,7,8). These training-induced adaptations are often thought
to be a result of increases in the content of myofibrillar proteins
(9,10) and MHC isoform proteins (6,7,8) which is presumed to occur from
increased expression of MHC isoform mRNA. However, little is known
at the present time about the MHC gene expression characteristics in
response to high-intensity strength training in humans.
Increases in the abundance
of MHC isoform protein content contributes to increases in the content
of myofibrillar protein and could be a result of: 1) enhanced transcription
of MHC isoform mRNA thereby resulting in more mRNA molecules being translated
or 2) increased rate of translation of each molecule of mRNA (11).
It has also been concluded that increased muscle protein synthesis may
also be caused by molecular events occurring post-transcriptionally
(9). We categorize the term pre-translational as the events altering
the abundance of mRNA. Incidentally, abundance is the algebraic
sum of transcription, mRNA processing, and mRNA stability. The
term translational indicates changes in the synthesis of protein in
relation to mRNA activity while post-translational is indicative of
the modification of protein (i.e., phosphorylation, proteolysis, etc.).
At the present time, few studies
exist investigating MHC isoform mRNA expression in response to high-intensity
strength training in humans. Most strength training studies investigating
the response of MHC to training in humans have focused on the protein
isoforms. As a result, it is well established that the MHC protein
isoforms undergo training-induced transitions to a slower phenotype
(IIx IIa I). In humans, it has been shown
that after 3 weeks of immobilization 12 weeks of weight training of
the knee extensors produced no significant changes in the mRNA of the
three MHC isoforms (12). Similarly, it has also been shown in
elderly humans that 7 days of weight training of the knee extensors
at 80% of maximum had no significant change on MHC isoform mRNA levels
(11). Using a qualitative method of the polymerase chain reaction
(PCR) technique, we have recently shown (13) that the relative expression
of Type I and IIa MHC mRNA in the elderly may increase after high-intensity
weight training such that it is similar to the respective changes in
MHC protein expression observed in other studies (6,7,8). However,
the major weakness associated with the qualitative PCR technique is
that it only provides the ability to detect the presence or absence
of the target mRNA and, at best, can only be pseudo-quantified based
on normalization to an external control standard. Therefore, in
order to better determine MHC isoform mRNA expression using PCR, a quantitative
method should be used.
Regardless of the PCR procedure
used, it should be noted that in steady-state, mRNA expression usually
parallels the pattern of MHC protein expression; therefore, it is assumed
that MHC expression is primarily regulated at the pre-translational
level (14). However, mechanical overload such as with strength
training may actually create a mismatch between the relative expression
of MHC mRNA and protein suggesting that upregulation of the MHC isoform
genes as a result of exercise may not be directly correlated to the
synthesis of the respective MHC protein. Presently, however, there
is a limited amount of data available on MHC isoform mRNA expression
after high-intensity strength training. As a result, the purpose
of this study was to two-fold and sought to: 1) determine the steady-state
level of MHC isoform mRNA abundance and MHC gene expression characteristics
in response to high-intensity strength training and 2) compare the MHC
mRNA expression after training using a quantitative and qualitative
method of PCR.
METHODS
Subjects
Twelve untrained males with
an meanSD
age of 19.880.53
yrs, height of 180.133.00 cm, and body weight of 74.637.92
kg volunteered to participate in the study and were randomly assigned
to either a control group [CON, (n = 6)] which involved no strength
training or a strength training group [STR, (n = 6)]. Subjects
with contraindications to exercise as outlined by the American College
of Sports Medicine (ACSM) and/or who had engaged in consistent weight
training 6 months prior to the study were not allowed to participate.
All eligible subjects signed university-approved informed consent documents,
and approval was given by the Institutional Review Board for Human Subjects.
Additionally, all experimental procedures involved in the study conformed
to the ethical consideration of the Helsinki Code. The subjects
were explained the purpose of the training program, the protocol to
be followed, and the experimental procedures to be used. Subjects
were also instructed to maintain their normal dietary regimen and to
not consume any type of sport supplements (e.g., creatine monohydrate,
protein powder, etc.) during the course of the study.
Muscle Biopsies
Percutaneous muscle biopsies
(20-30 mg) were obtained both before and after the 8-wk training period
for each subject. Initial biopsies were obtained 1 wk before the
initiation of exercise (to allow for adequate healing), and the follow-up
biopsies were completed within one hour following the final exercise
session. Muscle samples, extracted under local anesthesia (2%
Xylocaine), were taken from the middle portion of the right vastus lateralis
muscle at the midpoint between the patella and the greater trochanter
of the femur at a depth between 1 and 2 cm. For the post-training
biopsy, attempts were made to extract tissue from approximately the
same location by using the pre-biopsy scar and depth markings on the
needle. A successive incision was made approximately 0.5 cm to
the former from medial to lateral (13). Muscle specimens were
frozen in liquid nitrogen for later analysis.
Strength Testing and Thigh Volume Determination
Before and after the 8-wk training
period, both groups were subjected to a testing session in which each
subject's lower body maximum strength [one repetition maximum (1-RM)]
was determined using a bilateral leg press machine (Cybex, Owatonna,
MN). Due to differences in absolute muscular strength and body
weight between groups at the onset of the study, each subject's absolute
strength 1-RM was divided by their body weight to ascertain a relative
measure of strength. Relative strength was used as a criterion
variable because it corrects for variations in body weight among subjects,
thereby providing a more accurate estimate of strength (15,16).
Thigh volume (m3)
was estimated before and after the study from an equation and guidelines
outlined previously (17) taking into account surface measurements of
the length, circumference, and skin fold thickness of each subject's
right thigh. The measurement was performed in the supine position
and always prior to exercise to avoid the influence of possible exercise-induced
muscle swelling.
Training Protocol
The training principles of
overload and progressive resistance were incorporated in the weight
training program based on previously established guidelines (13,15,16).
In addition to the pre-test 1-RM, the 1-RM was assessed every two weeks
to continually evaluate muscular strength so that adjustments could
be made to accommodate for increases in strength and ensure that subjects
continued to train at 85%-90% of their 1-RM based on the repetition
continuum and guidelines previously established (18,19).
Training sessions occurred 3 days/wk on a Monday-Wednesday-Friday format for approximately 30
min/session (excluding warm-up
and cool-down). The format and intensity for the training protocol
involved 3 sets of 6-8 repetitions at 85%-90% 1-RM (8). A 90 sec
rest period was required between each set and each exercise to help
counteract fatigue (15). For warm-up and cool-down, workouts began
and ended with 10 min of flexibility exercises combined with calisthenics.
Members of CON did not participate in any weight training exercise during
the course of the study (other than the pre- and post-training strength
evaluations). Missed training sessions were made up on either
Tuesdays or Thursdays and subjects were informed that missing three
training sessions would result in disqualification from the study.
Total RNA Isolation
Total cellular RNA was extracted from the homogenate of biopsy samples with a monophasic solution of phenol and guanidine isothiocyanate (13,20,21). Specifically, the samples were homogenized and incubated with the TRI-reagent (Sigma Chemical Co., St. Louis, MO). The RNA was precipitated with isopropanol, washed with 70% ethanol, and re-suspended in dH2O. The RNA concentration was determined by optical density (OD) at 260 nm (by using an OD260 equivalent to 40 g/L), and the final concentration was adjusted to 1 g/L (5,12,20). Aliquots (5 L) of total RNA samples were then separated with 1% agarose gel electrophoresis, ethidium bromide stained, and monitored under an ultraviolet light to verify RNA integrity and absence of RNA degradation. This procedure yielded undegraded RNA, free of DNA and proteins, as indicated by prominent 28s and 18s ribosomal RNA bands (Figure 1), as well as an OD260/OD280 ratio of approximately 2.0 (5,13,21). The RNA samples were stored at -70C until later analyses.
Two g of total skeletal muscle RNA were reverse transcribed to synthesize cDNA (21). A reverse transcription (RT) reaction mixture [2 g of cellular RNA, 10x reverse transcription buffer (20 mM Tris-HCL, pH 8.3;50 mM KCl;2.5 mM MgCl2; 100 g of bovine serum albumin/ml), a dNTP mixture containing 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 0.8 M MgCl2, 1.0 U/L of rRNasin (ribonuclease inhibitor), 0.5 g/L of oligo(dT)15 primer, and 25 U/g of AMV reverse transcriptase enzyme (Promega, Madison, WI)] was incubated at 42C for 60 min, heated to 95C for 10 min, and then quick-chilled on ice. Starting template concentration was standardized by adjusting the RT reactions for all samples to 200 ng prior to PCR amplification (5).
The 5'-oligonucleotide for
each polymerase chain reaction (PCR) amplification was designed from
a highly conserved region in all known human MHC genes approximately
600 base pairs (bp) upstream of the stop codon. The three adult MHC
isoforms (Type I, IIa, and IIx) are identical in this region, which
enabled us to use the same "common sense" upstream primer
with the following sequence: 5'-GCCAAGAAGGCCATCAC-3'(13,21,22).
The 3'-oligonucleotide antisense (downstream) primers used in the PCR
reactions were designed from the 3'-untranslated regions of each of
the different MHC genes, where the sequences are highly specific for
each MHC gene (Table 1) (13,21,22). We have previously shown these
primers to amplify PCR products of 623, 655, and 609 bp, respectively,
for Type I, IIa, and IIx MHC mRNA (13,21).
Table 1: 3’-Oligonucleotide RNA Primers Used for PCR Amplification
MHC mRNA | Antisense Primer |
*Sample
CDNA |
*Control
Fragment |
I | 5'CAAGAAGCTGTTACACAGGCTCCAGCATGGGGCTTTGCTGGCACC3' | 623 bp | 462 bp |
IIa | 5'GCTTTATTTCCTTTGCAACAGGGTAGAATACACAATAATTACAGAGGG3' | 655 bp | 510 bp |
IIx | 5'TGGAGTGACAAAGATTTTCACATTTTGTGCATTTCTTTGGTCACC3' | 609 bp | 555 bp |
*Sample cDNA is the size of MHC mRNA product from PCR amplification in base pairs (bp); *Control fragment is the size of
the internal DNA control standard (bp) co-amplified with the sample cDNA during PCR amplification using the same sense
An internal DNA control standard was constructed by a technique of oligonucleotide overlap extension and amplification by PCR with a primer annealing temperature of 55C (5,23). The control standard uses the common primer as its 5'-oligonucleotide and contains the three MHC-specific isoform sequences as its 3'-oligonucleotide. The particular, unrelated, "uncommon sequence" originated from a stretch of coding region of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, which has little or no sequence homology to any of the relevant MHC genes.
The internal DNA control standard
generated from PCR was cloned into a modified transcription vector.
Prior to cloning, a T vector was constructed by cutting the pGEM-5Zf(+)
vector (Promega, Madison, WI) with the EcoR-V restriction endonuclease
and adding a 3'-terminal thymidine to both ends. The control fragment
was ligated into the vector with T4 DNA ligase and then cloned into
the pGEM-T Vector (Promega, Madison, WI); a vector in which the T7 and
SP6 RNA polymerase promoters flank a multiple cloning region within
the alpha-peptide coding region of the -galactosidase gene.
At this point, the vector was transformed into 1x108 cfu/g DNA of competent JM109 E. coli bacterial cells (Promega, Madison, WI) by spreading aliquots of the ligation reaction onto agar plates containing Luria Broth (LB) and ampicillin [(AMP) Sigma Chemical Co., St. Louis, MO] and the cells grown overnight at 37C. Random cell colonies were chosen, cultured using LB and AMP, and the PCR product of the internal control standard was then purified from possible contaminants such as primer-dimers and amplification primers with the Wizard Plus Midipreps DNA Purification System (Promega, Madison, WI).
The identity of the PCR products
for the internal DNA control standard were verified by their specific
lengths in an ethidium-bromide stained agarose gel as a result of restriction
digestion. The internal DNA control standard sequence was cut
away from plasmid DNA with the EcoR-I restriction endonuclease enzyme
(Promega, Madison, WI) and PCR amplified with the respective MHC mRNA
oligonucleotides (Table 1) which yielded fragments of 462, 510, and
555 bp, respectively for MHC Type I, IIa, and IIx mRNA (Figure 2).
Further verification of the MHC control standard was determined by DNA
sequencing using the Silver Sequence DNA Sequencing System (Promega,
Madison, WI) according to manufacturer's guidelines.
The amount of restricted internal DNA control standard was quantitated by determining the absorbance at OD260. The purity of the fragment was further determined by determining the ratio of the absorbance between OD260/OD280 (5,13,21).
One pg of the internal control fragment and 200 ng of cDNA were added to each 25 L PCR reaction. For an absolute negative control, a separate PCR reaction was amplified containing no cDNA. Specifically, each PCR reaction contained the following mixtures: [10x PCR buffer, 0.2 M dNTP mixture, 1.0 M of a cocktail containing both the sense and antisense RNA oligonucleotide primers for MHC and either of the three primers specific for I, IIa, or IIx isoforms (purchased from Ransom Hill Biosciences, Ramona, CA) (Table 1), 2 mM MgCl2, 1.0 U/L of Taq DNA polymerase (Sigma, St. Louis, MO), and nuclease-free dH2O]. Each PCR reaction was amplified with a thermal cycler (Bio Rad, Hercules, CA). The amplification profile involved an initial denaturation step at 94C for 60 sec, followed by 25 cycles, with each cycle consisting of denaturation at 94C for 45 sec, primer annealing at 50C for 60 sec, and extension at 72C for 90 sec, and a final step of 72C for 180 sec (5). The number of cycles was optimized so that the amplified signal was still on the linear portion of a plot with the yield expressed as a function of the absorbance at OD260 and the number of cycles (Figure 3). To assess reliability between amplifications, two separate PCR amplifications were performed for each sample.
Figure 2. Electrophoresis of the internal DNA control standard after digestion with the EcoR-1 restriction endonuclease enzyme and PCR amplified with the respective MHC Type I, IIa, and IIx oligonucleotides. Lane 1 = 1 kb DNA MW marker; Lane 2 = Type IIx internal control standard (555 bp); Lane 3 = Type IIa internal control standard (510 bp); Lane 4 = Type I internal control standard (462 bp).
According to previous guidelines
(5), for quantitative PCR only the volume of the OD of a DNA band was
corrected to the local background such that it was directly proportional
to the amount of DNA over a wide range. Intensity (expressed in arbitrary
density units) of each MHC band was divided by the intensity of the
internal DNA control standard. The percent content of the mRNA
of each MHC isoform was then calculated based on the fraction of specific
MHC mRNA-corrected value relative to the total sum of expressed MHC
mRNA isoforms in a given sample. For example, %Type IIa MHC mRNA
= 100 x (Type IIa band intensity/corresponding control band intensity)/[sum
(MHC band/control band) for all three MHC mRNA isoforms](5).
Figure 4. Electrophoresis of quantitative and qualitative PCR products from pre- and post-test muscle biopsy samples for a CON and STR subject. A = Quantitative PCR: Lane numbers indicate the following: 1,5 = Type I MHC mRNA, 623 bp; 2,6 = Type IIa MHC mRNA, 655 bp; 3,7=Type IIx MHC mRNA, 609 bp; 4,8 = absolute negative control (no cDNA); 9=molecular weight PCR marker . In lanes 1,2,3,5,6,7 the lower band corresponds to the respective internal DNA control standard (Type I = 462 bp, IIa = 510 bp, IIx = 555 bp). Also, Lanes 1-4 indicate pre-test and 5-8 post test. B = Qualitative PCR: Lane numbers indicate the following: 1=molecular weight PCR marker, 2,6=alpha-actin [external control Standard (313 bp)], 3,7 = Type I MHC mRNA (623 bp), 4,8 = Type IIa MHC mRNA (655 bp), 5,9 = Type IIx MHC mRNA (609 bp). Lanes 2-5 indicate pre-test and 6-9 post-test.
Myofibrillar protein, still remaining in the phenol phase left over from the total RNA isolation procedure, was isolated with isopropanol, washed with 0.3 M guanidine hydrochloride, and dissolved in 1% SDS (24). Protein content was then determined spectrophotometrically based on the Bradford method at a wavelength of 595 nm and using bovine serum albumin as the standard (25).
Separate two-way (Group x Test) analysis of variance (ANOVA) procedures were employed to determine significant differences for the following criterion variables: 1) body weight, 2) thigh volume, 3) strength, 4) percent mRNA of the three MHC isoforms, and 5) myofibrillar protein content. Separate independent-groups t-tests were performed to determine significant differences for the percent change from pre- to post-testing for the above-mentioned criterion variables. Additionally, to assess reliability between PCR reactions, paired t-tests were performed for each subject within both groups for the pre- and post-training biopsy samples. A probability level of 0.05 was adopted throughout for all statistical analyses.
During the course of the study,
there was no significant Group x Test interaction (F(2,15)=0.14,
p>0.05) for body weight (Table 2). Also, in regard to percent
changes in body weight from pre- to post-test, there were no significant
differences (p>0.05) among the two groups.
As a result of the strength
training program, significant Group x Test interactions were found for
muscle strength (F(2,15)=10.44, p=0.007) and thigh volume (F(2,15)=5.50,
p=0.02). Analysis of the main effects revealed no significant
differences between CON and STR at pre-test for either strength (F(2,15)=1.56,
p=0.85) or thigh volume (F(2,15)= 2.13, p=0.23). At the end of
the study for CON, there were still no significant differences noted
for strength or volume; however, STR was significantly different from
CON for both strength (F(2,15)=8.33, p=0.005) and volume (F(2,15)=10.65,
p=0.007).
In regard to the percent changes from pre- to post-training for muscle strength, results showed average increases of 2.721.56 and 48.538.10%, respectively, for CON and STR. For thigh volume, increases of 0.602.44 and 11.868.67% were seen for CON and STR, respectively. For strength and volume, the changes observed for STR were significantly different (p<0.05) from CON.
RT-PCR analysis yielded amplification
products of 623, 655, and 609 bp, respectively, for the Type I, IIa,
and IIx MHC mRNA isoforms (upper bands, Figure 4). Also, co-amplification
of the internal DNA control standard yielded amplification products
of 462, 510, and 555 bp, respectively for Types I, IIa, and IIx MHC
(lower bands, Figure 4A).
For the abundance of MHC isoform
RNA present in each of the samples for both groups, significant Group
x Test interactions were located for Type I (F(2,15)=13.81, p=0.002),
IIa (F(2,15)=11.61, p=0.001), and IIx (F(2,15)=13.81, p=0.002).
Analysis of the main effects showed no significant differences between
CON and STR at pre-test for the expression of the Type I (F(2,15) =0.614,
p=0.55), IIa (F(2,15)=0.81, p=0.46), and IIx (F(2,15)=0.21, p=0.89)
MHC mRNA. At the end of the study for CON, there were no significant
differences noted in abundance for any of the three MHC isoforms.
However, after training for STR, there were significant differences
detected in abundance for MHC I MHC mRNA that were significantly different
from CON.
In regard to the percent change
in mRNA abundance from pre- to post-test for the two groups, results
for CON revealed meanSD increases of 1.813.22 and 2.495.82%, and a decrease of 1.888.68%,
respectively, for the Type I, IIa, and IIx MHC isoforms (Table 2).
In addition, for STR there were average increases of 17.085.35
and 15.898.32%,
and a decrease of 49.6922.38%, respectively, for Type I, IIa,
and IIx that were all significantly different from CON (p<0.05).
Table 2: Group Means (SD) for the Criterion Variables
Pre-Test | Post-Test | % Change | |
Group CON | |||
Body Weight (kg) | 75.033.21 | 75.783.45 | 1.060.54) |
Rel. Strength | l 2.700.41 | 2.740.41 | 1.501.49) |
Thigh Volume (m3) | 5.581.11 | 5.651.09 | 0.062.44) |
Protein (g/ml) | 21.942.08 | 23.960.97 | 9.495.99) |
% MHC I mRNA# | 44.037.86 | 44.656.92 | 1.414.63) |
% MHC IIa mRNA# | 41.076.43 | 41.874.94 | 2.495.82) |
% MHC IIx mRNA# | 13.904.63 | 13.483.75 | 1.868.68) |
MHC I mRNA@ | 984.5656.97 | 992.6582.76 | 0.821.47) |
MHC IIa mRNA@ | 756.2646.83 | 766.4558.36 | 1.342.67) |
MHC IIx mRNA@ | 328.5836.87 | 340.1738.95 | 3.522.79) |
Group STR | |||
Body Weight (kg) | 80.2310.01 | 85.2910.77 | 6.312.45 |
Rel. Strength | 2.690.25 | 3.880.51* | 44.096.36** |
Thigh Volume (m3) | 7.461.36 | 8.391.97* | 10.947.17** |
Protein (g/ml) | 24.392.99 | 47.3512.77* | 92.0924.68** |
% MHC I mRNA# | 42.508.32 | 49.519.77* | 17.085.35** |
% MHC IIa mRNA# | 37.287.89 | 42.816.95* | 15.898.32** |
% MHC IIx mRNA# | 20.172.44 | 7.673.63* | -49.6922.38** |
MHC I mRNA@ | 976.4766.37 | 1,166.9598.82* | 19.518.34** |
MHC IIa mRNA@ | 781.5856.28 | 986.8465.60* | 26.2612.84** |
MHC IIx mRNA@ | 404.1447.03 | 324.7123.93* | -19.659.27** |
*Significant from CON at the
post-test (p < 0.05); **Significant change from pre- to post-test
(p < 0.05); Results for % MHC mRNA are based on the arbitrary
densities of PCR amplified MHC products relative to the co-amplified
internal standard as illustrated in Figure 4. The equation for calculating
% MHC mRNA is described in the Methods section and elsewhere (5). #quantitative
PCR; @qualitative PCR (numbers expressed in arbitrary density
units).
Considering intra-assay reliability
related to the consistency in mRNA abundance between the two PCR amplifications
within each group, results showed no significant differences (p>0.05)
for the three MHC isoforms. Additionally, the mean intra-assay
coefficient of variations for the two PCR amplifications for CON were
0.030.04,
0.020.04,
and 0.030.03
for Type I, IIa, and IIx, respectively, while the respective coefficients
for STR were 0.0250.005, 0.0240.01, and 0.0140.14.
Qualitative Comparison of MHC mRNA Isoform Expression
Myosin heavy chain isoform
mRNA expression patterns were compared between all subjects within the
two groups. Expression was determined by pseudo-quantification
from the arbitrary density units of stained gels. No significant
differences were detected at the pre-test for either CON or STR. However,
at the post-test for STR significant differences were found for Type
1 (F(2,15)=26.43, p=0.002), IIa (F(2,15)=6.38, p=0.002), and IIx (F(2,15)=9.60,
p=0.001) MHC mRNA. In regard to the percent change in expression
between the pre- and post-test for MHC mRNA, CON showed no apparent
differences in the Type I, IIa, and IIx isoforms. However, STR
was expressing significantly more of the Type I (19.518.34%) and Type IIa (26.2612.84%)
MHC isoforms with a concomitant decrease in the Type IIx (19.659.27%)
mRNA isoform (Table 2 & Figure 4B).
Myofibrillar Protein Content
For myofibrillar protein content,
a significant Group x Test interaction (F(2,15)=9.74, p=0.006) was located.
Analysis of the main effects revealed no significant difference between
CON and STR at pre-test (F(2,15)=2.31, p=0.63). However, at the
end of the study protein content for CON was not significant while STR
was significantly different from CON (F(2,15)=11.44, p=0.008).
In regard to the percent changes from pre- to post-training for myofibrillar protein content (Table 2), results showed average increases of 9.495.99 and 92.0924.68%, respectively, for CON and STR. The changes observed for STR were significantly different (p<0.05) from CON.
In terms of the physiology
of muscle adaptation to strength training exercise, it is important
for exercise physiologists to understand the molecular mechanisms in
which MHC genes may be sensitive to the intensity of the external training
load. As a result, we may become more strategic at designing and
implementing strength training programs that effectively manipulate
the expression of the MHC genes which play a significant role in increasing
muscle strength and hypertrophy. Studies investigating the effects
of weight training on MHC gene expression in humans is limited, and
most of the available data involves rodent models.
As can be seen from Figure
4B, qualitative PCR only provides the ability to pseudo-quantify MHC
isoform mRNA expression from the intensity of ethidium bromide staining
and normalized to alpha-actin as an external, positive control standard.
As a result, qualitative PCR is only able to detect the presence or
absence of MHC mRNA in a given sample and does not provide the ability
for accurate quantitation. Ethidium bromide staining with agarose
gel electrohporesis and comparison of the target mRNA to the control
mRNA only highlights differences in staining intensities which can possibly
illustrate differences in mRNA content (Figure 4B). However, without
knowing the concentration of the starting template, our attempts to
normalize expression compared to alpha-actin is problematic for two
reasons: 1) there is no quantification and standardization of the initial
starting concentration of cDNA, and 2) since different primer pairs
were used to amplify the MHC compared to the alpha-actin, fully correcting
for efficiency of the PCR amplification is not possible. Therefore,
this method of qualitative PCR is strictly descriptive and does not
lend itself well to the determining of the abundance of MHC isoform
mRNA as does our quantitative technique (Figure 4A).
Based on our modifications
from previously established guidelines (5), in this study we employed
a method of competitive PCR specific for quantitating MHC isoform mRNA
expression in humans. The PCR method described here involves a
constitutively expressed gene that is amplified simultaneously in the
same reaction as the target MHC mRNA sequence, and corrected relative
to the constitutive gene. Also, to correct for variability in
PCR reaction efficiency, a known amount (1 pg) of an internal DNA control
standard was added to each reaction and amplified simultaneously with
the MHC mRNA by using the same set of primers as the MHC mRNA but yielding
a product of different size. As can be seen in Figure 4A, each
PCR reaction resulted in co-amplification of the MHC mRNA and the internal
DNA control standard. The upper band corresponds to the higher
molecular weight MHC mRNA while the lower band corresponds to the lower
molecular weight internal DNA control fragment. The intensity
of the upper bands is indicative of the abundance of the specific MHC
mRNA in the total RNA sample relative to the internal DNA control standard.
This method of competitive RT-PCR can accurately estimate the abundance
of MHC mRNA in a given sample (5); although, this method only provides
the accurate comparison of the relative amount of mRNA expression of
each MHC isoform in a given sample.
The results of this study are
in agreement with other studies which have shown that periods of 8-19
wks of high-intensity strength training were effective in significantly
increasing strength (6,7,8). In regard to thigh volume, however,
there were no significant changes (p>0.05) in thigh skin fold thickness
noted for CON (1.560.04%) and STR (1.120.02%) (data not shown). Therefore,
the primary increase in volume measurements most likely came from thigh
girth. It is possible that increases in thigh volume could have
been due to increases in intramuscular and/or interstitial fluid levels;
however, based on the observed increases in muscle strength and myofibrillar
protein content it is more reasonable to assume that the increased volume
occurred as a result of hypertrophy of the thigh musculature.
The present results illustrate
significant training-induced increases in myofibrillar protein that
are in agreement with previous studies (9,10). During weight training-induced
hypertrophy, there is an increased accumulation of non-contractile and
contractile proteins. The net quantity of these proteins is a
result of synthesis vs. degradation rates and it appears that myofibrillar
protein synthesis seems to be regulated at the translational or post-translational
level (26). The present results also show that pre-exercise steady-
state MHC mRNA levels are similar to other research involving humans
(11) in that non-exercised muscle expresses a greater percentage of
the Type I isoform with IIa also expressing more than IIx. Our
results also illustrate that high-intensity strength training seems
to cause fast to slow transitions in MHC isoform mRNA expression that
seem to parallel the transitions in MHC protein isoforms seen in other
studies (6,7,8). The fact that we showed increased in MHC
isoform mRNA expression compared to other studies which did not (11,12)
could be due to the higher training intensity and/or length of the training
period of the present study.
The results of the present
study also indicate a significant increase in the abundance of Type
I and IIa MHC mRNA after training coupled with a concomitant decrease
in the abundance of Type IIx. The decreased abundance in the Type IIx
isoform could be due to the premise that the IIx gene is known as the
"default gene" (27) and is very sensitive to high intensity
resistance training and altered mechanical loading and differing muscle
contraction velocities. A study with rodents has shown increased
Type IIx MHC mRNA expression after high-resistance treadmill training
(28). Therefore, based on the mode and intensity of the training
stimulus, and possibly the animal model used, the Type IIx gene may
have the ability to either preferentially increase or decrease its expression
based on the recruitment profiles of the muscle fibers during the activity.
Since high-intensity strength training involves large contractile efforts
but slow velocity of shortening of the muscle fibers, the Type IIb muscle
fibers may not be as heavily recruited as the Type I and IIa fibers
(29). As a result, muscle fiber recruitment profiles related to
training intensity (load) and speed of contraction may have played a
role in dictating down-regulation in the expression of the Type IIx
gene. As a result, this could imply that, in regard to the principle
of specificity, the weight training intensity may actually play a key
role in the differential expression of the Type I, IIa, and IIx MHC
genes. Therefore, training regimens should be specific based on
the type of exercsie and/or sport of participation.
Increasing the mRNA template
available for translation and protein synthesis in muscle during hypertrophy
can be a reflection of alterations in transcriptional efficiency, transcriptional
capacity, and/or mRNA stability. The results of this study indicate
that increases in Type I and IIa MHC mRNA abundance occur concomitant
with increases in myofibrillar protein content. Therefore, a possible
relationship may exist between the up-regulation of MHC Type I and IIa
gene expression and high-intensity strength training that is necessary
to support the training-induced increases in muscle strength and thigh
volume observed in this study.
It should be noted, however,
that the method of mRNA quantitation employed in this study is only
reflective of steady- state levels of mRNA at the time of biopsy.
When interpreting the MHC isoform mRNA expression during periods of
physical inactivity, MHC mRNA and protein expression is often shown
to occur in the same direction (26). However, during periods of
training and muscle hypertrophy, a mismatch seems to occur between the
relative content of MHC mRNA and protein levels which may be reflective
of differential timing between up- and down-regulation of MHC transcripts
and their protein isoforms (29). This mismatch between pre-translational
and translational activity may be due to the transient (0-4 hours post-exercise)
nature of MHC gene expression compared to MHC protein expression (3-36
hours post-exercise) (26). As a result of the transient nature
of mRNA expression, more than a single time point of mRNA determination
may be required to confirm absolute interpretations of regulatory sites
in MHC gene expression.
_________________________________________________________________________________________
REFERENCES
Address for Correspondence:
Darryn S. Willoughby, Ph.D., Molecular Physiology Laboratory, Department of Kinesiology, Texas Christian University, TCU Box 297730, Fort Worth, TX 76129, Tel: 817-257-7665, Fax: 817-257-7702, e-mail: d.willoughby@tcu.edu
All Rights Reserved Powered by Free Document Search and Download
Copyright © 2011