Home > OLVADÁSIGÖRBE ANALÍZIS A SPECIFIKUS PCR VÉGTERMÉKEK KIÉRTÉKELÉSÉBEN

OLVADÁSIGÖRBE ANALÍZIS A SPECIFIKUS PCR VÉGTERMÉKEK KIÉRTÉKELÉSÉBEN


 OLVADÁSGÖRBE ANALÍZIS A SPECIFIKUS PCR VÉGTERMÉKEK KIÉRTÉKELÉSÉBEN 
 

 Szerzők: RADVÁNSZKY J��nos1, REŠKO P��ter1, PÁLFFY Roland2, BAŤOVÁ Monika 3 

 T��mavezetők: Mgr. MINÁRIK Gabriel, PhD.1, RNDr. KÁDASI Lajos, PhD.1 

 Int��zm��ny: 1Comenius Egyetem, Term��szettudom��nyi kar, Molekul��ris Biol��gia tansz��k

 Bratislava, Szlov��kia

 2Comenius Egyetem, Orvostudom��nyi kar, Patofiziol��giai int��zet

 Bratislava, Szlov��kia

 3Comenius Egyetem, Term��szettudom��nyi kar, Mikrobiol��gia ��s Virol��gia tansz��k

 Bratislava, Szlov��kia 
 
 
 

 BEVEZETŐ

 A polimer��z l��ncreakci�� hagyom��nyos ki��rt��kel��si m��dszere az agar��z- ��s a poliakrilamid g��lelektrofor��zis, melyek sor��n a DNS fragmentumok ��gynevezett interkal��l��d�� vegy��letek ��s UV f��ny seg��ts��g��vel vannak vizualiz��lva. A legelterjedtebb ilyen interkal��ci��s vegy��let az etidium-bromid. Az elektrofor��zis sor��n a DNS fragmentumok a hosszuk szerint vannak megk��lönböztetve. Nagymennyis��gű vizsg��lt minta eset��n viszont az ilyen elektrofor��zison alapul�� met��dus meglehetősen idő- ��s munkaig��nyes. 

 A 20. sz��zad 90-es ��veiben ker��lt kifejleszt��sre egy met��dus, amely lehetőv�� tette a PCR amplifik��ci�� val��s idejű fluorimetri��s nyomon követ��s��t. Az erre a c��lra kifejlesztett berendez��sek, vagyis a real-time PCR k��sz��l��kek bevezet��s��vel a PCR reakci�� ki��rt��kelhetőv�� v��lt a reakci��ed��nyek kinyit��sa- ��s a PCR v��gterm��kekkel val�� tov��bbi manipul��ci�� n��lk��l [Higuchi et al. 1992; Gibson et al. 1996; Heid et al. 1996]. Az amplifik��ci�� folyamata a reakci�� eg��sz ideje alatt folyamatosan követve van ��s az amplifik��ci��s görbe seg��ts��g��vel lehetőv�� v��lik a templ��t DNS (vagy RNS) kezdetbeli mennyis��g��nek meghat��toz��sa.

 A v��gterm��k felsokszoroz��d��s��nak detekt��l��s��nak egyik legelterjedtebb m��dszere a real-time PCR k��sz��l��kekben az olyan fest��kanyagok felhaszn��l��sa, melyek be��p��lnek a kettőssz��l�� DNS molekul��ba. Ilyen dsDNS-fest��k p��ld��ul a SYBR Green I, YO-PRO-1, BEBO, Eva Green, SYTO9, stb, melyeket a tov��bbiakban az SLD (SYBR Green Like Dyes) rövid��t��ssel jelöl��nk. Ezek köz��l a DNS-fest��kek köz��l a leggyakrabban haszn��lt a SYBR Green I (SG), melynek a kettőssz��l�� DNS-re kötődve kb. 1000-szer erősebb a f��nyemisszi��ja, mint szabad ��llapot��ban [Wittwer et al. 1997]. Az ��jabb dsDNS specifikus fest��kek egyike az EvaGreen (EG), melynek a gy��rt�� szerint n��h��nyszorosan erősebb a f��nyemisszi��ja, összehasonl��tva a SYBR Green I-el [http://www.biotium.com...].

 A real-time berendez��sek megjelen��se egy tov��bbi ��jdons��got is mag��val hozott, m��gpedig az olvad��spont anal��zis lehetős��g��t (Melting Curve Analysis).  Az olvad��spont anal��zis lehetőv�� teszi a PCR v��gterm��kek azonos��t��s��t az olvad��spontjuk (melting temperature - Tm) meghat��roz��sa ��ltal. A fragmentum olvad��spontja az a hőm��rs��klet, amelyn��l 50% az adott fragmentumnak egysz��l��, ��s fők��pp a fragmentum b��zisösszet��tel��től (GC tartalom) ��s hossz��t��l f��gg. Az olvad��spont tov��bb�� f��gg a jelenlevő interkal��l��d�� anyagok, denatur��ci��s anyagok (pl. DMSO) ��s s��k (pl. MgCl2) koncentr��ci��j��t��l [Ririe et al. 1997; Jung et al. 2001; Giglio et al. 2003; Payungporn et al. 2004]. Az olvad��spont anal��zis leggyakrabban a m��r eml��tett SLD-k felhaszn��l��s��val van elv��gezve ��s a fluoreszcencia hőm��rs��klettől val�� f��ggv��ny��t ��br��zolja. Az olvad��si görbe a vizsg��lt minta hőm��rs��klet��nek fokozatos emel��s��vel ��s a fluoreszcencia ��lland�� figyel��s��vel kaphat�� meg. Ahogy a dsDNS denatur��l��dik, felszabadulnak az addig kötött SLD molekul��k, minek következt��ben a fluoreszcencia csökken. Vagyis a f��nyemisszi�� csökken a hőm��rs��klet fokozatos emelked��s��vel ��s a term��k denatur��ci��j��val. Így a PCR reakci�� ut��n elv��gzett olvad��spont anal��zis helyettes��theti a g��lelektrofor��zis sz��ks��gess��g��t.  

 A bemutatott munka fő c��lja az olvad��spont anal��zis bevezet��se ��s optimaliz��ci��ja a specifikus PCR v��gterm��kek ki��rt��kel��s��re, amely helyettes��theti a hagyom��nyos, de hosszadalmas g��lelektrofor��zis haszn��lat��nak sz��ks��gess��g��t. Erre a c��lra a laborat��riumunkban egy, m��r sikeresen haszn��lt ARMS PCR reakci��t v��lasztottunk ki, melynek seg��ts��g��vel a GJB2 (gap junction protein β-2) g��n 35delG mut��ci��j��t vizsg��ljuk. A munka tov��bbi c��ljai a következők voltak: ellenőrizni a met��dus megb��zhat��s��g��t az összes vizsg��lt minta elektrofor��zissel tört��nő ki��rt��kel��s��vel is; meghat��rozni a denatur��ci��s anyagok (pl. DMSO) hat��s��nak m��rt��k��t a PCR v��gterm��kek olvad��spontj��ra; összehasonl��tani a hagyom��nyosan haszn��lt SYBR Green I fest��k tulajdons��gait az ��jabb, hasonl�� elven működő EvaGreen fest��k tulajdons��gaival ��s ellenőrizni a met��dus felhaszn��lhat��s��g��t m��s PCR reakci��k ki��rt��kel��s��nek eset��ben is. Ez ut��bb eml��tett c��lra a GJB2 g��nben tal��lhat�� következő mut��ci��, a W24X, ��s k��t polimorfizmus, az R127H ��s GJB2-SNP1 szint��n ARMS PCR met��dussal val�� meghat��roz��sa mellett döntött��nk.     

 VIZSGÁLATI ANYAG ÉS MÓDSZEREK

 A munka sor��n vizsg��lt 100 DNS minta a Comenius Egyetem Term��szettudom��nyi kar��nak molekul��ris biol��gia tansz��k��nek DNS bankj��b��l sz��rmazott. A DNS mint��k perif��ri��s v��rből lettek izol��lva modifik��lt fenol-kloroformos met��dussal [Kunkel et al. 1977].

 A 35delG ��s a W24X mut��ci��k meghat��roz��s��ra haszn��lt primerek Scott et al. (1988) munk��ja alapj��n lettek megtervezve, a k��t polimorfizmus (R127H, GJB2-SNP1) meghat��roz��s��ra pedig a munkahely��nkön megtervezett primerek lettek felhaszn��lva. A kontroll, vagy k��lső fragmentumhoz a D9S938 genetikai marker (MapPairsTM Weber Screening Set Version 6A, Research Genetics) primereit haszn��ltuk. A primerek (Invitrogen) szekvenci��i ��s megjelöl��sei az 1. ��s 2. t��bl��zatban vannak felt��ntetve.  

 

         

 Mut��ci��/polimorfizmus

   ARMS specifikus primerek

   Kontroll (k��lső) primerek

   Forward primer    Reverse primer    Forward primer    Reverse primer
   35delG    35delG-NOR    35delG-COM    D9S938 forward    D9S938 reverse
   35delG-MUT
   W24X    W24X-NOR    35delG-COM    D9S938 forward    D9S938 reverse
   W24X-MUT
   R127H    R127H-NOR    GJB2 seq.int.-R2    -    35delG-COM
   R127H-MUT
   GJB2-SNP1    GJB2-SNP1-C    GJB2-SNP1 reverse    D9S938 forward    D9S938 reverse
   GJB2-SNP1-T
 
 

 1. t��bl��zat: A GJB2 g��n egyes mut��ci��inak ��s polimorfizmusainak meghat��roz��s��ra haszn��lt primerek jelöl��se. 


   Primer    Szekvencia
   35delG-NOR    5´ ttggggcacgctgcagacgatcctggggag 3´
   35delG-MUT    5´ ttggggcacgctgcagacgatcctggggat 3´
   35delG-COM    5´ gaagtagtgatcgtagcacacgttcttgca 3´
   W24X-NOR    5´ caaacactccaccagcattggaaagatcgg 3´
   W24X-MUT    5´ caaacactccaccagcattggaaagatcga 3´
   R127H-NOR    5´ ccacagggagccttcgattt 3´
   R127H-MUT    5´ ccacagggagccttcgatac 3´
   GJB2 seq.int.-R2    5´ gaacaaacactccaccagca 3´
   GJB2-SNP1-C    5´ tgctcagctgtcaaggctcagtcgac 3´
   GJB2-SNP1-T    5´ tgctcagctgtcaaggctcagtcgat 3´
   GJB2-SNP1 reverse    5´ cagcctggggtctcagtggaactaac 3´
   D9S938 forward    5´ gtaaggggttgaggttttgc 3´
   D9S938 reverse    5´ caccacatttctgacatcca 3´

 2. t��bl��zat: A felhaszn��lt primerek szekvenci��i.  

  Az összes ��ltalunk elv��gzett ARMS reakci�� eset��ben azonos összet��telű reakci��elegyet haszn��ltunk, mely 40μl v��gt��rfogat�� volt a 35delG reakci��k eset��ben (20μl a W24X, R127H es a GJB2-SNP1eset��ben). A reakci��elegy összet��tele a következő volt: 1x PCR puffer (S1,5); 150μmol.l-1 az egyes dNTP-kből; 0,25μmol.l-1 ARMS specifikus primerek; 0,1μmol.l-1 kontroll primerek; 1U (resp. 0,5U) Taq DNA polimer��z (Invitrogen) ��s megfelelő mennyis��gű v��z. A reakci��k kivitelez��s��hez GA 9700 (Applied Biosystems, USA), illetve GA 2700 (Applied Biosystems, USA). A munka sor��n haszn��lt PCR reakci��k algoritmusai az 1. ��br��n vannak felt��ntetve.   

                                              1. ��bra: Az ��ltalunk haszn��lt ARMS PCR reakci��k algoritmusai  

 A 35delG ARMS reakci��kat 100 DNS mint��n v��gezt��k el. A klasszikus ARMS PCR reakci��k ut��n a PCR-term��kek jelenl��t��t olvad��spont anal��zissel hat��roztuk meg a MiniOpticonTM System (Bio-Rad Laboratories, USA) berendez��s ��s a bevezetőben eml��tett EvaGreen dsDNS specifikus fest��k seg��ts��g��vel. 10μl PCR-term��khez hozz��adtuk a megfelelő mennyis��gű (5μl) EvaGreen fest��ket (v��gleges koncentr��ci�� 1x). Az EG ��s SG tulajdons��gainak összehasonl��t��sa ��rdek��ben tov��bbi 10μl term��khez (az azonos reakci��b��l) hozz��adtuk a megfelelő mennyis��gű (5μl) SYBR Green I fest��ket (v��gleges koncentr��ci�� 1x). Az olvad��spont anal��zis az eml��tett real-time berendez��sben lett elv��gezve a berendez��s ��ltal haszn��lt Opticon Monitor Analysis Software 3.1 version. A software lehetőv�� teszi k��lönböző param��terek be��ll��t��s��t, mint pl. az anal��zis hőm��rs��kleti tartom��ny��t, a hőm��rs��klet emelked��s��nek m��rt��k��t ��s a fluoreszcenciaszint m��r��si idej��nek hossz��t. A munka egyik alap c��lja e param��terek optimaliz��ci��ja, hogy az anal��zis kellően gyors legyen ��s kellően megk��lönböztethető p��keket adjon multiplex reakci��k eset��n.

 A met��dus megb��zhat��s��g��nak ellenőrz��sek��ppen a mint��k genot��pus��t meghat��roztuk agar��z g��lelektrofor��zis seg��ts��g��vel is (1,5%; 1xTBE; 5V/cm; 0,15mA; 50-75μg/200ml etidium bromid).

 A denatur��ci��s anyagok, PCR-term��kek olvad��spontj��ra val�� hat��s��nak vizsg��lat��ra a 35delG ARMS reakci�� term��k��t felosztottuk több egyenlő r��szre (10μl), melyekhez hozz��adtunk 5μl (3x) EvaGreen fest��ket. Az egyes r��szekhez a következőkben hozz��adtunk megfelelő mennyis��gű dimetilszulfoxidot (DMSO, 100%) ��s vizet (a sz��ks��ges DMSO koncentr��ci�� el��r��s��hez) 30μl összt��rfogatra. A vizsg��lt koncentr��ci��k a következők voltak: 0%, 2%, 4%, 6%, 8%, 10%, 12%, 14%, 16%, 18%, 20%.

 A k��t kettőssz��lra kötődő DNS fest��k (EG, SG) tulajdons��gainak összehasonl��t��s��ra a következő ��rt��keket haszn��ltuk: olvad��spont (Tm); a p��k magass��ga (-dI/dTmax); a p��k sz��less��ge °C-ban a maxim��lis –dI/dT ��rt��k fel��ben (FWHM; Full Width Half Maximum).    

 EREDMÉNYEK

 Munk��nk sor��n siker��lt bevezetn��nk egy ��j met��dust a specifikus PCR-term��kek ki��rt��kel��s��re, m��gpedig az „end point” olvad��spont anal��zist real-time PCR berendez��sben. A met��dus bevezet��s��t ��s tesztel��s��t egy specifikus ARMS PCR reakci��n v��gezt��k, mely a GJB2 g��n 35delG mut��ci��j��nak detekt��l��s��ra szolg��l. Siker��lt optimaliz��lnunk az anal��zis param��tereit, miközben az anal��zis időtartam��t ��s ��rz��kenys��g��t vett��k figyelembe. Az ��ltalunk kiv��lasztott param��terek a következők voltak: hőm��rs��kleti tartom��ny 70°C-t��l 95°C-ig; hőm��rs��kletemelked��s 0,2°C; fluoreszcencia m��r��s 2s. Az anal��zis időtartam ilyen be��ll��t��sok mellet 35 perc. A munka tov��bbi r��szeiben a le��rt a param��tereket haszn��ltuk. 

 A met��dus megb��zhat��s��g��t ��s pontoss��g��t mind a 100 ��ltalunk kivizsg��lt minta p��rhuzamos g��lelektrofor��zissel tört��nő ki��rt��kel��s��vel siker��lt bebizony��tanunk. Az olvad��sgörbe anal��zis seg��ts��g��vel tört��nt ki��rt��kel��s az esetek 100%-ban ugyanolyan eredm��nyhez vezetett, mint a g��lelektrofor��zissel tört��nő ki��rt��kel��s.

 A 35delG ARMS reakci�� specifikus term��ke az eg��szs��ges all��l eset��ben 202bp hossz�� ��s 54% GC tartalm��, a del��ci��s all��l eset��ben pedig 201bp hossz�� ��s ��gyszint��n 54% GC tartalm��. A D9S938 marker pontos szekvenci��ja nem ��llt rendelkez��s��nkre. Hossza megközel��tőleg 400bp ��s a GC tartalma a sz��m��t��sok szerint 35 ��s 43% között lehet. Az olvad��sgörbe anal��zis alapj��n szerzett eredm��nyek a 2. ��br��n vannak felt��ntetve. A 3. t��bl��zatban az ��ltalunk kapott eredm��nyek sz��mbeli ki��rt��kel��se l��that��. A kontroll fragmentum ��rt��keit k��lön ��rt��kelt��k a specifikus term��k jelenl��te, vagy nem jelenl��te eset��ben.

 

2. ��bra: A 35delG ARMS reakci�� ki��rt��kel��s��re v��gzett olvad��sgörbe anal��zis grafikus eredm��nyei. A – heterozig��ta; B – eg��szs��ges homozig��ta; C – mut��ns homozig��ta; a1, b1, c1 a fluoreszcencia intenzit��s��nak v��ltoz��s��t ��br��zol�� görb��k; a2, b2, c2 – a fluoreszcencia intenzit��s��nak v��ltoz��s��nak első negat��v deriv��ci��j��t ��br��zol�� görb��k. Piros görbe – eg��szs��ges all��l, zöld görbe – mut��ns all��l KP - kontroll fragmentum; ŠP – specifikus term��k

      


 Tm [°C ]  Kontroll +  Kontroll -  Specifikus NOR  Špecifikus MUT
    Átlag Tm  78,96  79,39  86,91  86,73
    Min. Tm  76,6  76,2  85,8  86,2
    Max. Tm  80,0  80,2  88,2  87,8
    SD  0,63  0,52  0,37  0,39

 3. t��bl��zat: 100 minta olvad��spont anal��zise ��ltal kapott ��tlag, minimum ��s maximum olvad��spont ��rt��kek az egyes fragmentumoknak megfelelően. Kontroll+ - kontroll fragmentum a specifikus term��k amplifik��ci��ja eset��n; Kontroll- – kontroll fragmentum a specifikus fragmentum jelenl��te n��lk��l; specifikus NOR – az eg��szs��ges all��l amplifik��ci��ja ��ltal kapott term��k; specifikus MUT – a mut��ns all��l amplifik��ci��ja ��ltal kapott term��k; SD – standard elt��r��sek. Az ��rt��kek °C-ban vannak megadva.     

 

3. ��bra: K��lönböző DMSO koncentr��ci��k Tm-re (35delG ARMS specifikus term��k) gyakorolt hat��s��nak ��br��zol��sa. A p��kek felett az egyes DMSO koncentr��ci��k vannak felt��ntetve (0%-tol 20%-ig)  

Siker��lt tov��bb�� meghat��roznunk a denatur��ci��s anyagok k��lönböző koncentr��ci��inak hat��s��t a specifikus PCR-term��k olvad��spontj��ra. Az eredm��nyek grafikus ��br��zol��sa a 3. ��br��n, a numerikus eredm��nyek pedig a 4. t��bl��zatban vannak felt��ntetve.

       


 %  0  2  4  6  8  10  12  14  16  18  20
 Tm   [°C]  86,6  84.2  83.0  81.6  79.8  79.0  77.8  76.6  75.2  74.0  71.0

 4. t��bl��zat: K��lönböző DMSO koncentr��ci��k Tm-re (35delG ARMS specifikus term��k) gyakorolt hat��s��nak sz��mbeli ki��rt��kel��se.

   

 Az ��gy szerzett eredm��nyek alapj��n elk��sz��tett��k a kalibr��ci��s görb��t is, mely a 4. ��br��n tal��lhat��.

  

4. ��bra: Kalibr��ci��s görbe, mely a 35delG ARMS reakci�� k��lönböző DMSO koncentr��ci��kkal v��gzett olvad��spont anal��zis eredm��nyeiből lett elk��sz��tve.

y = -0,7009x + 85,991     

R2 = 0,9878

 

 Az EG illetve SG seg��ts��g��vel v��gzett olvad��spont anal��zisek eredm��nyeinek összehasonl��t��s��val kapott eredm��nyek az 5. ��s 6. ��br��n vannak felt��ntetve. A sz��mbeli ��rt��kek az 5.a)-c) t��bl��zatokban vannak felt��ntetve.

            

 5. ��bra: Az olvad��spont anal��zis görb��i (-dI/dT ��br��zol��s) ugyanazon 35delG ARMS reakci�� eset��n EG ��s SG fest��kek felhaszn��l��s��val. A p��ld��ban egy eg��szs��ges homozig��ta van felt��ntetve. A - az összes görbe egyszerre val�� ��br��zol��sa. B - a mut��ci��s all��l identifik��l��s��ra szolg��l�� reakci�� ��br��zol��sa EG ��s SG felhaszn��l��s��val (teh��t csak a kontroll fragmentum van jelen). C - az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci�� ��br��zol��sa, szint��n EG ��s SG felhaszn��l��s��val. Piros görbe – a mut��ns all��l detekt��l��s��ra ir��nyul�� reakci�� EG felhaszn��l��s��val; zöld görbe – az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci�� EG felhaszn��l��s��val; k��k görbe – a mut��ns all��l detekt��l��s��ra ir��nyul�� reakci�� SG felhaszn��l��s��val; s��rga görbe – az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci�� SG felhaszn��l��s��val. 

          

 

6. ��bra: A 35delG ARMS reakci��k ki��rt��kel��s��vel kapott Tm (A), FWHM (B) ��s –dI/dTmax (C) ��rt��kek grafikus ��br��zol��sa. KP+ – kontroll fragmentum a specifikus term��k jelenl��t��ben; KP- – kontroll fragmentum a specifikus term��k n��lk��li reakci��kban; SP NOR – specifikus term��k az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci��b��l; SP MUT – specifikus term��k a mut��ns all��l detekt��l��s��ra ir��nyul�� reakci��b��l; EG – EvaGreen; SG – SYBR Green I. 

 

  A)


 Tm [°C ]  KP+  KP-  SP NOR  SP MUT
 EG  SG  EG  SG  EG  SG  EG  SG
 Átlag  78,96  79,93  79,39  81,84  86,91  87,24  86,73  87,21
 Min.  76,6  77,2  76,2  79,8  85,8  85,8  86,2  86,0
 Max.  80  83  80,2  84,4  88,2  88,8  87,8  88,4
 SD  0,63  1,16  0,52  0,99  0,37  0,6  0,39  0,66

 B)


 FWHM [°C ]  KP  SP NOR  SP MUT
 EG  SG  EG  SG  EG  SG
 Átlag  18,565  22,79  9,133  12,248  8,444  11,72
 Min.  6,549  5,354  6,161  3,11  6,534  6,426
 Max.  32,25  45,07  13,13  19,39  10,76  17,94
 SD  7,603  8,699  1,716  3,122  1,296  3,76

 C)


 -dI/dT max  KP  SP NOR  SP MUT
 EG  SG  EG  SG  EG  SG
 Átlag  0,005633  0,003699  0,007432  0,003821  0,005215  0,003711
 Min.  0,000541  0,000493  0,001916  0,001378  0,001532  0,000992
 Max.  0,014440  0,008007  0,021420  0,007415  0,009839  0,007455
 SD  0,003090  0,001628  0,003906  0,001339  0,002388  0,001627

 5. t��bl��zat: A 35delG ARMS reakci��k ki��rt��kel��s��vel kapott Tm (A), FWHM (B) ��s –dI/dTmax (C) ��rt��kek. KP+ – kontroll fragmentum a specifikus term��k jelenl��t��ben; KP- – kontroll fragmentum a specifikus term��k n��lk��li reakci��kban; SP NOR – specifikus term��k az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci��b��l; SP MUT – specifikus term��k a mut��ns all��l detekt��l��s��ra ir��nyul�� reakci��b��l; EG – Eva Green; SG – SYBR Green I. SD - standard elt��r��sek.   
 

 A met��dus felhaszn��lhat��s��g��t siker��lt bebizony��tanunk a m��r eml��tett tov��bbi 3 ARMS PCR reakci�� (W24X, R127H, GJB2-SNP1) eset��ben is. E reakci��k ki��rt��kel��s��vel szerzett eredm��nyek ��s adatok a 7. ��br��n ��s 6.a)-c) t��bl��zatokban l��that��ak.   

                   

       

       

 7. ��bra: A 3 ARMS PCR reakci�� (W24X, R127H, GJB2-SNP1) ki��rt��kel��s��vel szerzett eredm��nyek. A) olvad��sgörb��k, melyeken j��l megk��lönböztethető a specifikus term��k ��s a kontroll term��k. Mindh��rom esetben heterozig��ta minta van ��br��zolva. Zöld görbe – az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci��; piros görbe – a mut��ns all��l detekt��l��s��ra ir��nyul�� reakci��. B) a kisz��m��tott ��tlag��rt��kek ��s standard elt��r��sek grafikus ��br��zol��sa; KP+ – kontroll fragmentum a specifikus term��k jelenl��t��ben; KP- – kontroll fragmentum a specifikus term��k n��lk��li reakci��kban; SP NOR – specifikus term��k az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci��b��l; SP MUT – specifikus term��k a mut��ns all��l detekt��l��s��ra ir��nyul�� reakci��b��l 

 A) W24X


 Tm [°C ]  Kontroll +  Kontroll -  Specifikus NOR  Specifikus MUT
 Átlag Tm  78,4  79,8  85,95  86,10
 Min. Tm  76,4  78,6  85,8  85,8
 Max. Tm  79,2  79,4  86,4  86,4
 SD  0,88  0,29  0,21  0,28
 
 
 
 
 
 
 

 B) R127H


 Tm [°C ]  Kontroll +  Kontroll -  Specifikus NOR  Specifikus MUT
 Átlag Tm  85,4  85,76  88,83  89,00
 Min. Tm  84,0  85,2  88,4  88,4
 Max. Tm  86,2  86,4  89,4  89,4
 SD  0,62  0,55  0,41  0,30
 

 C) GJB2-SNP1


 Tm [°C ]  Kontroll +  Kontroll -  Specifikus NOR  Specifikus MUT
 Átlag Tm  78,82  79,46  83,64  83,88
 Min. Tm  78,2  78,6  82,8  83,6
 Max. Tm  79,8  80,6  84,2  84,0
 SD  0,62  0,55  0,43  0,23
 

 6. t��bl��zat: A 3 ARMS PCR reakci�� (W24X, R127H, GJB2-SNP1) ki��rt��kel��s��vel szerzett eredm��nyek. A t��bl��zatban a kisz��m��tott ��tlag, minim��lis ��s maxim��lis Tm ��rt��kek, tov��bb�� a standard elt��r��sek vannak felt��ntetve. A) W24X; B) R127H; C) GJB2-SNP1. KP+ – kontroll fragmentum a specifikus term��k jelenl��t��ben; KP- – kontroll fragmentum a specifikus term��k n��lk��li reakci��kban; SP NOR – specifikus term��k az eg��szs��ges all��l detekt��l��s��ra ir��nyul�� reakci��b��l; SP MUT – specifikus term��k a mut��ns all��l detekt��l��s��ra ir��nyul�� reakci��b��l. SD - standard elt��r��sek. 

 MEGVITATÁS

 A dolgozatban bemutatott munka a specifikus PCR reakci��k ki��rt��kel��s��nek lehetős��g��vel foglalkozott olvad��spont anal��zis felhaszn��l��s��val olyan esetekben, amelyekben kvalitat��v ki��rt��kel��sre van sz��ks��g, teh��t el��g az „end-point” ki��rt��kel��s (mint a klasszikus g��lelektrofor��zissel val�� ki��rt��kel��s eset��n). Az ��ltalunk bevezetni pr��b��lt m��dszer sor��n a PCR reakci�� klasszikus PCR berendez��s seg��ts��g��vel van elv��gezve, m��g a ki��rt��kel��s real-time berendez��sben van elv��gezve. V��lem��ny��nk szerint ez a m��dszer több előnnyel is j��r, melyek köz��l a legfontosabb, hogy elimin��lja a hosszadalmas ��s munkaig��nyes g��lelektrofor��zis sz��ks��gess��g��t. Az anal��zis eredm��nyei sz��m��t��g��p ��ltal vannak feldolgozva, egyszerűv�� t��ve a ki��rt��kel��st ��s az adatok tov��bbi t��rol��s��t. Tov��bb��, mivel maga a PCR reakci�� az eddig haszn��lt PCR berendez��s seg��ts��g��vel van elv��gezve, ��s a DNS fest��k csak a reakci�� befejez��se ut��n van hozz��adva az oldathoz, nincs sz��ks��g a PCR reakci�� felt��teleinek ��jabb standardiz��ci��j��ra ��s megszűnik a dsDNS fest��k inhib��ci��s tulajdons��gaival kapcsolatos probl��ma is [Zipper et al. 2004].

 Az anal��zis időtartama ��s az eredm��nyek pontoss��ga között, mint m��r eml��tve volt, kompromisszumot kellett kötn��nk. Az ��ltalunk v��gzett anal��zisek elv��gz��s��hez az eredm��nyek fejezetben felt��ntetett be��ll��t��sok mellett döntött��nk. Egy ilyen anal��zis időtartama 35 perc, miközben az ��ltalunk haszn��lt berendez��sben 48 minta lehet ki��rt��kelve (mivel ARMS reakci��kkal dolgoztunk, ez 24 minta egyszerre). Viszont az olvad��spont anal��zis m��s reakci��kban val�� felhaszn��l��sa eset��n a reakci�� param��terei be��ll��that��ak m��s szempontok szerint, amivel az anal��zis elv��gz��s��hez sz��ks��ges idő jelentősen csökkenhet. Az anal��zis elv��gz��s��hez sz��ks��ges idő tov��bb�� v��ltozhat a felhaszn��lt real-time PCR berendez��s t��pus��t��l f��ggően is.

 Az ��ltalunk felhaszn��lt met��dus megb��zhat��s��g��t siker��lt bebizony��tanunk az összes ��ltalunk elv��gzett reakci�� p��rhuzamos g��lelektrofor��zissel val�� ki��rt��kel��s��vel is. Az eredm��nyek mindk��t ki��rt��kel��si m��dszerrel azonosak voltak, teh��t az ��gy elv��gzett olvad��spont anal��zis legal��bb annyira pontos, mint a g��lelektrofor��zist felhaszn��l�� ki��rt��kel��s. Ezekkel azonosak voltak tov��bb�� az SG fest��k felhaszn��l��s��val kapott eredm��nyek is (melyek prim��risan a k��t fest��k összehasonl��t��s��ra szolg��ltak).

 Mint azt a bevezetőben eml��tett��k, a dsDNS fragmentum olvad��spontj��ra több t��nyező is hat��ssal van, melyek köz��l az elsők között szerepel a b��zisösszet��tel (GC tartalom) ��s a fragmentum hossza. A specifikus fragmentum hossza 202bp, ill. 201bp, GC tartalma 54%, olvad��spontja pedig megközel��tőleg 87°C. A kontroll fragmentum hossza megközel��tőleg 400bp, GC tartalma 35-43% között, olvad��spontja pedig megközel��tőleg 79°C.  Teh��t a hosszabb de kisebb GC tartalm�� fragmentum olvad��spontja alacsonyabb, mint a rövidebb, de magasabb GC tartalm�� fragmentum olvad��spontja. Ezen eredm��nyek szerint ahhoz a meg��llap��t��shoz jutottunk, hogy a fragmentum b��zisösszet��tele m��rvad��bb t��nyező az olvad��spontra, mint a hossz��s��ga. Tov��bb�� a fragmentum olvad��spontja, mint m��r eml��tett��k f��gg az oldatban jelenl��vő denatur��ci��s anyagok koncentr��ci��j��t��l. A k��lönböző DMSO koncentr��ci��val v��gzett m��r��sek alapj��n siker��lt bizony��tanunk az olvad��spont line��ris csökken��s��t az emelkedő DMSO koncentr��ci��j��val. Tov��bb��, eredm��nyeink szerint a kontroll fragmentum Tm ��rt��ke alacsonyabb volt a specifikus fragmentum jelenl��t��ben, mint azokban a reakci��kban, amelyekben a specifikus term��k nem volt jelen. Ez a megfigyel��s arra engedett következtetni, hogy a fragmentum olvad��spontj��ra a felsoroltakon k��v��l hat��st gyakorol egy��b fragmentumok jelenl��te is.

 A k��t dsDNS fest��k (EG, SG) összehasonl��t��sa 3 ��rt��k figyelembev��tel��vel ��s összehasonl��t��s��val tört��nt, m��gpedig a Tm ��rt��kek, a kapott p��kek alakja ��s nagys��ga. Az ��ltalunk ki��rt��kelt 100 minta alapj��n szerzett ��tlag Tm ��rt��kek magasabbak voltak az SG felhaszn��l��sa eset��n. Az ��tlag��rt��kekhez viszony��tott minim��lis ��s maxim��lis Tm ��rt��kek nagyobb kileng��st mutattak az SG haszn��lata eset��n, mint az EG haszn��lta eset��n, ami arra enged következtetni, hogy az EG haszn��lata az olvad��spont anal��zis sor��n pontosabb ��rt��kekhez vezethet. Erről tan��skodnak a jelentősen kisebb standard elt��r��sek is az EG haszn��lata eset��ben. A kontroll fragmentum Tm ��rt��keinek összehasonl��t��sa a specifikus term��k jelenl��t��ben, illetve n��lk��le a következő eredm��nyekhez vezetett: a specifikus term��k jelenl��te n��lk��l 1.) nagyobb k��lönbs��g az ��tlag Tm ��rt��kek között az EG, illetve SG eset��ben; 2.) kisebb m��rvad�� elt��r��sek EG ��s SG eset��ben is. Ez a megfigyel��s is al��t��masztja a felt��telez��s��nket, miszerint az olvad��spontra hat��ssal van m��s term��kek jelenl��te is az oldatban. A Tm ��rt��kek összehasonl��t��s��hoz hasonl��an, az FWHM ��s a      -dI/dTmax ��rt��kek összehasonl��t��sa is ahhoz a következtet��shez vezettek, hogy az EG haszn��lata jobb eredm��nyekhez j��rul hozz��. Az FWHM ��s –dI/dT ��rt��kek ar��nylag nagy ��tlag��rt��kektől val�� kileng��se megmagyar��zhat�� azzal a t��nnyel, hogy a m��r��sekhez haszn��lt egyes DNS mint��k koncentr��ci��ja nem volt egyforma, ��gy a v��gterm��kek mennyis��ge is val��sz��nűleg k��lönböző volt. Ha figyelembe vessz��k, hogy a p��k alatti ter��let ar��nyos a term��k mennyis��g��vel [Al-Robaiy et al. 2001], akkor a p��k sz��less��ge ��s magass��ga is f��ggő kell legyen, a term��k mennyis��g��től. Munk��nk sor��n viszont ezen ��rt��keket csak a k��t dsDNS fest��k tulajdons��gainak összehasonl��t��s��n��l haszn��ltuk fel, minek sor��n egyazon mint��k lettek ki��rt��kelve EG ��s SG felhaszn��l��s��val. Teh��t a PCR term��kek k��lönböző mennyis��ge nem kellett volna, hogy befoly��solja az összehasonl��t��shoz felhaszn��lt eredm��nyeket.

 A dolgozatban bemutatott eredm��nyekkel siker��lt bebizony��tanunk az olvad��spont anal��zis felhaszn��lhat��s��g��t specifikus PCR v��gterm��kek real-time PCR berendez��sben val�� „end-point” ki��rt��kel��s��re. A le��rt met��dus ��gy helyettes��theti az eddig haszn��lt, idő- ��s munkaig��nyes g��lelektrofor��zis hasonl�� c��lokra tört��nő felhaszn��l��s��t. A munka sor��n tov��bb�� siker��lt meg��llap��tani, hogy az EvaGreen elnevez��sű dsDNS fest��k alkalmasabb erre a c��lra, mint a hagyom��nyosan haszn��lt SYBR Green I fest��k.  

 FELHASZNÁLT IRODALOM

  1. Al-Robaiy, S., Rupf, S., Eschrich, K.  (2001): Rapid competitive PCR using melting curve analysis for DNA quantification. Biotechniques 31, 1382-6, 1388.
  2. Gibson, U. E., Heid, C. A., Williams, P. M.  (1996): A novel method for real time quantitative RT-PCR. Genome Research 6, 995-1001.
  3. Giglio, S., Monis, P. T., Saint, C. P.  (2003): Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Res 31, e136.
  4. Heid, C. A., Stevens, J., Livak, K. J., Williams, P. M.  (1996): Real time quantitative PCR . Genome Research 6, 986-94.
  5. Higuchi, R., Dollinger, G., Walsh, P. S., Griffith, R.  (1992): Simultaneous amplification and detection of specific DNA sequences. Bio/Technology 10, 413-7.
  6. http://www.biotium.com/product/price_and_info.asp?item=31000&Sub_Section=09A
  7. Jung, M., Muche, J. M., Lukowsky, A., Jung, K., Loening, S. A.  (2001): Dimethyl sulfoxide as additive in ready-to-use reaction mixtures for real-time polymerase chain reaction analysis with SYBR Green I dye . Analytical Biochemistry 289, 292-5.
  8. Kunkel, L. M., Smith, K. D., Boyer, S. H., Borgaonkar, D. S., Wachtel, S. S., Miller, O. J., Breg, W. R., Jones, H. W. Jr, Rary, J. M.  (1977): Analysis of human Y-chromosome-specific reiterated DNA in chromosome variants. Proceedings of the National Academy of Sciences of the United States of America 74, 1245-9.
  9. Payungporn, S., Tangkijvanich, P., Jantaradsamee, P., Theamboonlers, A., Poovorawan, Y.  (2004): Simultaneous quantitation and genotyping of hepatitis B virus by real-time PCR and melting curve analysis. Journal of Virological Methods 120, 131-40.
  10. Ririe, K. M., Rasmussen, R. P., Wittwer, C. T.  (1997): Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Analytical Biochemistry 245, 154-60.
  11. Scott, D. A., Kraft, M. L., Carmi, R., Ramesh, A., Elbedour, K., Yairi, Y., Srisailapathy, C. R., Rosengren, S. S., Markham, A. F., Mueller, R. F., Lench, N. J., Van Camp, G., Smith, R. J., Sheffield, V. C.  (1998): Identification of mutations in the connexin 26 gene that cause autosomal recessive nonsyndromic hearing loss. Human Mutation 11, 387-94.
  12. Wittwer, C. T., Ririe, K. M., Andrew, R. V., David, D. A., Gundry, R. A., Balis, U. J.  (1997): The LightCycler: a microvolume multisample fluorimeter with rapid temperature control. Biotechniques 22, 176-81.
  13. Zipper, H., Brunner, H., Bernhagen, J., Vitzthum, F.  (2004): Investigations on DNA intercalation and surface binding by SYBR Green I, its structure determination and methodological implications. Nucleic Acids Res 32, e103.

 

 

Set Home | Add to Favorites

All Rights Reserved Powered by Free Document Search and Download

Copyright © 2011
This site does not host pdf,doc,ppt,xls,rtf,txt files all document are the property of their respective owners. complaint#nuokui.com
TOP